View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5377_low_4 (Length: 361)
Name: NF5377_low_4
Description: NF5377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5377_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 2e-80; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 77 - 232
Target Start/End: Original strand, 53134921 - 53135076
Alignment:
| Q |
77 |
atcattaatgctaaggaaatagcagatgatgagagtttattttgcgatgacaagaagctcgtgtatttgcgagcggtgtttatcttatagtatagtactt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53134921 |
atcattaatgctaaggaaatagcagatgatgagagtttattttgcgatgacaagaagctcgtgtatttgcgagcggtgtttatcttatagtatagtactt |
53135020 |
T |
|
| Q |
177 |
ccatgactctgatgcttatttttagtacttaagttttatatcttataaaactctgg |
232 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53135021 |
ccatgactctgatgcttttttttagtacttaagttttatatcttataaaactctgg |
53135076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 304 - 346
Target Start/End: Original strand, 53135142 - 53135184
Alignment:
| Q |
304 |
agcaagtagcaagtgatgagagttattttgtgataaggagaag |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53135142 |
agcaagtagcaagtgatgagagttattttgtgataaggagaag |
53135184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 2 - 31
Target Start/End: Original strand, 53134842 - 53134871
Alignment:
| Q |
2 |
ttattctattgattttaattatgatcatca |
31 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
53134842 |
ttattctattgattttaattatgatcatca |
53134871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 53135155 - 53135211
Alignment:
| Q |
103 |
tgatgagagtttattttgcgatgacaagaagctcgtgtatttgcgagcggtgtttatc |
160 |
Q |
| |
|
||||||||||| |||||| ||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
53135155 |
tgatgagagtt-attttgtgataaggagaagctcgtgtatttgcgagcgatgtttatc |
53135211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University