View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5377_low_8 (Length: 278)

Name: NF5377_low_8
Description: NF5377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5377_low_8
NF5377_low_8
[»] chr1 (1 HSPs)
chr1 (15-266)||(50747814-50748065)


Alignment Details
Target: chr1 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 15 - 266
Target Start/End: Complemental strand, 50748065 - 50747814
Alignment:
15 agtttttgcaactgaatttgttgtcttctgatttggctatgcagtaatccataactggatcaggatcagaacaaaaaacagcaatgatgaaacacataag 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50748065 agtttttgcaactgaatttgttgtcttctgatttggctatgcagtaatccataactggatcaggatcagaacaaaaaacagcaatgatgaaacacataag 50747966  T
115 aactaaaagaatggttactttgttgttgatcatggttttgaaacttaactatttcttgcaggaaccaaataatgtgtttggttgaatgactttgcttcac 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50747965 aactaaaagaatggttactttgttgttgatcatggttttgaaacttaactatttcttgcaggaaccaaataatgtgtttggttgaatgactttgcttcac 50747866  T
215 atattgtttcatcaattattgagtgtcatatttataggccatgggatatttt 266  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||    
50747865 atattgtttcatcaattattgagtgtcatatttataggccatgggatttttt 50747814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University