View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5378_high_14 (Length: 273)
Name: NF5378_high_14
Description: NF5378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5378_high_14 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 19 - 273
Target Start/End: Original strand, 39245216 - 39245470
Alignment:
| Q |
19 |
tttattccttcacctcttactctattttgactagtattccaacaaaatctcatgaccacactaaataaacatctgtttgtggtatgcttgacacacttca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39245216 |
tttattccttcacctcttactctattttgactagtattccaacaaaatctcatgaccacactaaataaacatctgtttgtggtatgcttgacacacttca |
39245315 |
T |
|
| Q |
119 |
caactaaccaaaatcaccgtaaacacatgtttattttttggatataggatgagttttttaggtggttgaataatgttcactttattttccattatgttca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39245316 |
caactaaccaaaatcaccgtaaacacatgtttattttttggatataggatgagttttttaggtggttgaataatgttcactttattttccattatgttca |
39245415 |
T |
|
| Q |
219 |
ttggggtccagactttgtagctatttagttggaatagttggggtcttgtgatttc |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39245416 |
ttggggtccagactttgtagctatttagttggaatagttggggtcttgtgatttc |
39245470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University