View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5378_low_12 (Length: 311)
Name: NF5378_low_12
Description: NF5378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5378_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 8 - 295
Target Start/End: Complemental strand, 32685366 - 32685061
Alignment:
| Q |
8 |
gagcagagaggcagcagcaagaggaggagccaagttgttaaaaaa------------------ctttgtaggaatgagattcacatgcttctcttcccgt |
89 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32685366 |
gagcagaaaggcagcagcaagaggaggagccaagttgttaaaaaacttgacttgttgttttgtctttgtaggaatgagattgacatgcttctcttcccgt |
32685267 |
T |
 |
| Q |
90 |
ttcacgttatcctgtaatcaatgtgaggctgaggttgcaacttgcatgcatcatcgttcataatcacactcaagaaaattaacagtgagagaagcaaggt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32685266 |
ttcacgttatcctgtaatcaatgtgaggctgaggttgcaacttgcatgcatcatcgttcataatcacactcaagaaaattaacagtgagagaaacaaggt |
32685167 |
T |
 |
| Q |
190 |
cttttacctacctttatggagacaggattattgtaaccagaaatcagacaagcaagcttcatttggcttcttttctatgctttatcatatctgagataga |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32685166 |
cttttacctacctttatggagacaggattattgtaaccagaaatcagacaagcaagcttcatttggcttcttttctatgctttatcatatcttagataga |
32685067 |
T |
 |
| Q |
290 |
tggatt |
295 |
Q |
| |
|
|||||| |
|
|
| T |
32685066 |
tggatt |
32685061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University