View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5378_low_20 (Length: 238)
Name: NF5378_low_20
Description: NF5378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5378_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 26 - 231
Target Start/End: Original strand, 33384431 - 33384636
Alignment:
| Q |
26 |
tcagatcctctttacttcaaaagtttagagctttcttcatatgcaatttactcggaaacagcgataacagctgtttggagaatggatatggagattatca |
125 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33384431 |
tcagatcttctttacttcaaaagtttagagctttcttcatatgcaatttactcggaaacagcgataacagctgtttggagaatggatatggagattatca |
33384530 |
T |
 |
| Q |
126 |
tggttctgatatctacaactctagcatgtgttttcgtcggattgcaactataccatgtcaagaaacacactaatgtgcttcccttcatctcaattttgat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
33384531 |
tggttctgatatctacaactctagcatgtgttttcgtcggattgcaactataccatgtcaagaaacacactaatgtgcttcccttcatctcagttttcat |
33384630 |
T |
 |
| Q |
226 |
gatgtc |
231 |
Q |
| |
|
|||||| |
|
|
| T |
33384631 |
gatgtc |
33384636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 97 - 231
Target Start/End: Original strand, 33378361 - 33378495
Alignment:
| Q |
97 |
tgtttggagaatggatatggagattatcatggttctgatatctacaactctagcatgtgttttcgtcggattgcaactataccatgtcaagaaacacact |
196 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| | || || |
|
|
| T |
33378361 |
tgtttggagaacggatatggaagttatcatggctctgatatctacaactctagcatgtgttttcgtcggattgcaactcaaccatgtgaagagaaaccct |
33378460 |
T |
 |
| Q |
197 |
aatgtgcttcccttcatctcaattttgatgatgtc |
231 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
33378461 |
aatgtgcttcccttcatctcaattttcatgatgtc |
33378495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 94 - 231
Target Start/End: Complemental strand, 26790814 - 26790677
Alignment:
| Q |
94 |
agctgtttggagaatggatatggagattatcatggttctgatatctacaactctagcatgtgttttcgtcggattgcaactataccatgtcaagaaacac |
193 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26790814 |
agctgtttggagaacggatatggagattatcatggttctgatatctacaactctagcatgtgttttcgtcggcctgcaactataccatgtcaagaaacac |
26790715 |
T |
 |
| Q |
194 |
actaatgtgcttcccttcatctcaattttgatgatgtc |
231 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
26790714 |
cctaatgtgcttcccttcatctcagttttcatgatgtc |
26790677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University