View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5379_low_8 (Length: 284)
Name: NF5379_low_8
Description: NF5379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5379_low_8 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 55 - 284
Target Start/End: Original strand, 5322321 - 5322550
Alignment:
| Q |
55 |
gactgaactctctgagcttgaaaaaatacacatatatctattttatattgtctcgtgatttactccgtaagtgatgtattcaacgacggtagtggctagt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5322321 |
gactgaactctctgagcttgaaaaaatacacatatatctattttatattgtctcgtgacttacaccgtaagtgatgtattcaacgacggtagtggctagt |
5322420 |
T |
 |
| Q |
155 |
tctctttcttagcttcggccactggtactttagtgagcagcgtcgttgacctaacgactgtcattgtatcacgtctgtctcatggacaggtgattgttgc |
254 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5322421 |
tctctttcttagcttcggccgctggtactttagtgagcagcgtcgttgacctaacgactgtcactgtatcacgtctgtctcatggaccggtgattgttgc |
5322520 |
T |
 |
| Q |
255 |
atgtttcggatttgacaacgtggaatcaga |
284 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
5322521 |
atgtttcggttttgacaacgtggaatcaga |
5322550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University