View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5380-Insertion-1 (Length: 228)
Name: NF5380-Insertion-1
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5380-Insertion-1 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 8 - 194
Target Start/End: Original strand, 11808901 - 11809087
Alignment:
| Q |
8 |
tggataagtttcaaggaccaaatgcttcaccaccaccattgtttagatattgttcagatcaatggagcttggatattgtcttcccagattggtccttttg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11808901 |
tggataagtttcaaggaccaaatgcttcaccaccaccattgtttagatattgttcagatcaatggagcttggatattgtgttcccagattggtccttttg |
11809000 |
T |
|
| Q |
108 |
gggatggtatgtcctaaacataacttcttttcttcctttctatttatagaaacatgtttaaatcacgagaattaagaaaattgatag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11809001 |
gggatggtatgtcctaaacataacttcttttcttcctttctatttatagaaacatgtttaaatcacgagaattaagaaaattgatag |
11809087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 16 - 158
Target Start/End: Original strand, 11801627 - 11801768
Alignment:
| Q |
16 |
tttcaaggaccaaatgcttcaccaccaccattgtttagatattgttcagatcaatggagcttggatattgtcttcccagattggtccttttggggatggt |
115 |
Q |
| |
|
|||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11801627 |
tttcaaggtccaaatgcttcaccacctcctttgtttagatattgttcagatcaatggagcttggatattgtcttcccagattggtccttttggggatggt |
11801726 |
T |
|
| Q |
116 |
atgtcctaaacataacttcttttcttcctttctatttatagaa |
158 |
Q |
| |
|
| | |||||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
11801727 |
aaatgctaaac-taacttcttttcatcctttctatttttagaa |
11801768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University