View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_high_30 (Length: 229)
Name: NF5381_high_30
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_high_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 50198922 - 50199130
Alignment:
| Q |
1 |
cccaacaaaattcaaaatatcatattaattagtacactcttttgaatgaactcaaaattcaaaatgtcttttggaacataagtttcataattttccaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
50198922 |
cccaacaaaattcaaaatatcatattaattagtacactcttttgaatgaactcaaaattcaaaatgtcttttggaacataagtttcataa-tttccaatt |
50199020 |
T |
|
| Q |
101 |
gaactatacataaatttcatgacaatttagtgccgaatttattgattttcattagccttacatagacacaccacacgtctcctctaatctatatattttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50199021 |
gaactatacataaatttcatgacaatttagtgccgaatttattga-tttcattagccttacatagacacaccacacgtctcctctaatctatatattttt |
50199119 |
T |
|
| Q |
201 |
gagtatgaatt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
50199120 |
gagtatgaatt |
50199130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University