View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_high_32 (Length: 226)
Name: NF5381_high_32
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 209
Target Start/End: Original strand, 30803677 - 30803877
Alignment:
| Q |
9 |
gagtagcatagggacagaaagctctcttcatcgagtttaagccaggaatgatacattttggatgcctttgaggcaagccaaaggacaaaggtcacaaatt |
108 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30803677 |
gagtagcatggggacagaaagctctcttcatcgagtttaagccaggaatgatacattttggatgcctttgaggcaagccaaaggacaaaggtcacaaatt |
30803776 |
T |
|
| Q |
109 |
aaagcagcatagaaggcatctcaatcttgatctcaatggttgaaccatataattaggtatgtaccataaaattaatattatgtaactgaaggttcaaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30803777 |
aaagcagcatagaaggcatctcaatcttgatctcaatggttgaaccatataattaggtatgtaccataaaattaatattatgtaactgaaggttcaaaat |
30803876 |
T |
|
| Q |
209 |
g |
209 |
Q |
| |
|
| |
|
|
| T |
30803877 |
g |
30803877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University