View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_high_36 (Length: 212)
Name: NF5381_high_36
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 17060013 - 17059839
Alignment:
| Q |
19 |
attctgtgagagtgagagatagaagaaagaaacctcataaatgttatggaagctaaataattaagaacaacgaaggtttaaagacaaaacaacttggggg |
118 |
Q |
| |
|
|||||| ||||||||||||| ||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17060013 |
attctgggagagtgagagatggaagaaaaacacctcataaaagttatggaagctaaataattaagaacaacgaaggtttaaagacaaaacaacttggggg |
17059914 |
T |
 |
| Q |
119 |
aactctttcttaagttccaaactcatatcaagaaaacaaggaaatatcttggtccatgtgatccacgcatggcaa |
193 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17059913 |
aactcttccttaagttccaaactcatatcaagaaaacaaggaaatatcttggtccatgtgatccacgcatggcaa |
17059839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 88 - 120
Target Start/End: Original strand, 43625682 - 43625714
Alignment:
| Q |
88 |
acgaaggtttaaagacaaaacaacttgggggaa |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43625682 |
acgaaggtttaaagacaaaacaacttgggggaa |
43625714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 117
Target Start/End: Original strand, 29539038 - 29539094
Alignment:
| Q |
61 |
gttatggaagctaaataattaagaacaacgaaggtttaaagacaaaacaacttgggg |
117 |
Q |
| |
|
||||||||||||| ||||| ||| | |||||||||| ||||||| ||||||||||| |
|
|
| T |
29539038 |
gttatggaagctagataatcaagtgcgacgaaggtttgaagacaatacaacttgggg |
29539094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University