View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_high_4 (Length: 458)
Name: NF5381_high_4
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_high_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 1e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 252 - 441
Target Start/End: Original strand, 45458803 - 45458990
Alignment:
| Q |
252 |
gaacttaagagcgtggttaaacattaaagtgaaatatagacatcccaaccctgttgacattcctaataaacatgctctactatacccactcataaaatga |
351 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45458803 |
gaacttaagagtgtggttaaacattaaagtgaaacgtagacatcccaaccctgttgacactcctaataaacatgctctacta--cccactcataaaatga |
45458900 |
T |
 |
| Q |
352 |
taaaatagcaatgatatttgtaggcagtaatgttgatcaaccacctttgagttcacctttagagcgaaagtaataggcagtgattcaagt |
441 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45458901 |
taaaatagcaatgatatttgtaggaagtggtgttgatcaaccacctttgagttcacctttagagcgaaagtaataggcagtgattcaagt |
45458990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 77 - 206
Target Start/End: Original strand, 45458628 - 45458757
Alignment:
| Q |
77 |
gtcaagtaactaatggttgacctgacacgccttgagagggaagaagtgtggatttcgatgtttgaacaccgacccttgcatgttattgttcttgcaacta |
176 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45458628 |
gtcaagtagctaatggttgacctgacacgccttgagaggggagaagtgtggatttcgatgtttgaacaccgacccttgcatgtcattgttcttgcaacta |
45458727 |
T |
 |
| Q |
177 |
acaattgaattgtaattacatgactcttgc |
206 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |
|
|
| T |
45458728 |
acaattgagttgaaattacatgactcttgc |
45458757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University