View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_low_10 (Length: 414)
Name: NF5381_low_10
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 13 - 396
Target Start/End: Original strand, 469594 - 469977
Alignment:
| Q |
13 |
tgagacggagttacagcagcgttgccttgattttgagactgaacatgaggaggagtaaaaggccacatgttttgtgtctgtgtttctgaatttgaagttg |
112 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
469594 |
tgagacggagttacagcagcgtttccttgattttgagactgtacatgaggat---taaaaggccacatgttttgtgtctgtgtttctgaatttgaagttg |
469690 |
T |
|
| Q |
113 |
ctgcaccaccactcaccggtaccatccaaattgtacttccactccctgctgtagcccacatggctgttgccggtaacatattcgatggtcgaagaagtcc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
469691 |
ctgcaccaccactcaccggtaccatccaaattgtacttccactccctgctgttgcccacatggctgttgccggtaacatattcgatggtcgaagaagtcc |
469790 |
T |
|
| Q |
213 |
agaaaaggaattacctatagaagaagatgaagaagct---ccaccaccaccgtcaccttcgcccatatcatcttgttgttgatgatttgttttgaaactt |
309 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
469791 |
agaaaaggaattacctattgaagaagatgaagaagctccaccaccaccaccgtcaccttcccccatatcatcttgttgttgatgatttgttttgaaactt |
469890 |
T |
|
| Q |
310 |
ttgggagaagtagaaccatcaccgtcaccaccactttcattttgattgttgttatcgtctttgaaaagatcttctctataccgtttt |
396 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
469891 |
ttgggagaagaagaaccatcaccgtcaccaccactttcattttgattgttgttatcttctttgaaaagatcttctctataccgtttt |
469977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 287 - 334
Target Start/End: Complemental strand, 46525612 - 46525565
Alignment:
| Q |
287 |
gttgatgatttgttttgaaacttttgggagaagtagaaccatcaccgt |
334 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
46525612 |
gttggtgatttgttttgaaacctttgggagaagaagaaccatcaccgt |
46525565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 292 - 334
Target Start/End: Complemental strand, 11437016 - 11436974
Alignment:
| Q |
292 |
tgatttgttttgaaacttttgggagaagtagaaccatcaccgt |
334 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
11437016 |
tgatttgttttgaaacctttgggagaagaagaaccatcaccgt |
11436974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 287 - 334
Target Start/End: Original strand, 1289374 - 1289421
Alignment:
| Q |
287 |
gttgatgatttgttttgaaacttttgggagaagtagaaccatcaccgt |
334 |
Q |
| |
|
|||| |||||||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
1289374 |
gttgctgatttgttttgaaacctttgggaaaagaagaaccatcaccgt |
1289421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University