View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_low_11 (Length: 410)
Name: NF5381_low_11
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 3e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 20 - 137
Target Start/End: Complemental strand, 39299679 - 39299562
Alignment:
| Q |
20 |
atgaacagaggaatgggaacaggacaagttgtggccgagaaaggaagaaaaacagaggatttaggaacaagaggtgaaggaaaagtacctggtgctggaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299679 |
atgaacagaggaatgggaacaggacaagttgtggcagagaaaggaagaaaaacagaggatttaggaacaagaggtgaaggaaaagtacctggtgctggaa |
39299580 |
T |
|
| Q |
120 |
atgtaggttcaatgtggg |
137 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
39299579 |
atgtaggttcgatgtggg |
39299562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 228 - 336
Target Start/End: Complemental strand, 39299471 - 39299363
Alignment:
| Q |
228 |
ttggtggtgaaaatgaaggtgtaatcttgggaaagagtgtagctgagcaaagaggaagagcgggtgctggaaatgaaggtgcaatgttgggaaaaagtgg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39299471 |
ttggtggtgaaaatgaaggtgtaatcttgggaaagagtgttgctgagcaaagaggaagagcgggtgctggaaatgaaggtgcaatgttgggaaaaagtgc |
39299372 |
T |
|
| Q |
328 |
tgctgaaca |
336 |
Q |
| |
|
||||||||| |
|
|
| T |
39299371 |
tgctgaaca |
39299363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University