View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_low_18 (Length: 312)
Name: NF5381_low_18
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 8 - 185
Target Start/End: Complemental strand, 49609817 - 49609640
Alignment:
| Q |
8 |
cgaagaatatcgtatctgggtaacccctgtctcatttattcataccacgattccactactcttgttttcttttgtttctttaatatctttcatcccttta |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49609817 |
cgaagaaaatcgtatctgggtaacccctgtctcatttattcataccacgagtccactactcttgttttcttttgtttctttaatatctttcatcccttta |
49609718 |
T |
 |
| Q |
108 |
cgcttttcaggccttagagattcccaatgtcgacggaactatctgtgtttacgacactgatgattccacaatctacgg |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49609717 |
cgcttttcaggccttagagattcccaatgtcgacgaaactatctgtgtttacgacactgatgattccaccatctacgg |
49609640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 183 - 295
Target Start/End: Complemental strand, 49609570 - 49609458
Alignment:
| Q |
183 |
cggtaaaggtctcatctccggtcgagcaaccacttgtgccatcatctcgtacattctctcatggtaaaattctgattatcacatttagtaaatagtagat |
282 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49609570 |
cggtaaaggtctcatctccggtcgcgcaaacacgtgtgccatcatctcgtacattctctcatggtaacattctgattatcacatttagtaaatagtagat |
49609471 |
T |
 |
| Q |
283 |
tgctcatagtttt |
295 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49609470 |
tgctcatagtttt |
49609458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 209 - 295
Target Start/End: Complemental strand, 49614624 - 49614538
Alignment:
| Q |
209 |
caaccacttgtgccatcatctcgtacattctctcatggtaaaattctgattatcacatttagtaaatagtagattgctcatagtttt |
295 |
Q |
| |
|
|||||| ||| |||||||||| |||||||||||||||||| |||| |||||||| |||| |||||||||||| |||||||||||| |
|
|
| T |
49614624 |
caaccagttgcgccatcatctgttacattctctcatggtaacattccaattatcacttttattaaatagtagatcgctcatagtttt |
49614538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 72 - 185
Target Start/End: Complemental strand, 49614832 - 49614720
Alignment:
| Q |
72 |
ttttcttttgtttctttaatatctttcatccctttacgcttttcaggccttagagattcccaatgtcgacggaactatctgtgtttacgacactgatgat |
171 |
Q |
| |
|
|||| |||||||||| ||| ||||| |||||||||| |||||||||| |||| ||||||| | ||||||||||||||| || ||| ||| |||| | |
|
|
| T |
49614832 |
ttttgttttgtttctcaaatctctttaatccctttac-cttttcaggctgaagagcttcccaacgacgacggaactatctgcgtatacaccaccgatgct |
49614734 |
T |
 |
| Q |
172 |
tccacaatctacgg |
185 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
49614733 |
tccaccttctacgg |
49614720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University