View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_low_21 (Length: 273)
Name: NF5381_low_21
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 48168143 - 48168414
Alignment:
| Q |
1 |
cactcatttatttagaattatattaagcctccagattgcacgacatattcatcgcttcactttcacgaacattgggaatatgatgt---cattcgttaag |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
48168143 |
cactcatttatttagaattatattaagcctccagattgcacgacatattcgttgcttcactttcacgaacattgggaatatgatgttgtcatccgttaag |
48168242 |
T |
|
| Q |
98 |
tgcttgtaagaaccaaccattttcatcattgtaggcaacggttaaaacttgtttatattagtaccttgagcaggcttacaccatgtcaaaattatagccc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48168243 |
tgcttgtaagaaccaaccattttcatcattgtaggcaacggttaaaacttgtttatattagtaccttgagcaggcttacaccatgtcaaaattatagccc |
48168342 |
T |
|
| Q |
198 |
agcaccattagatatcgcaagttcttggcttgattccaacgatcgaatacattacacctttctgtgctgctc |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| || ||||| |
|
|
| T |
48168343 |
agcaccattagatatcgcaagttcttggcttgattccaacgatcgaataaattacacctttctttgttgctc |
48168414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University