View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_low_26 (Length: 250)
Name: NF5381_low_26
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_low_26 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 250
Target Start/End: Complemental strand, 35029663 - 35029420
Alignment:
| Q |
7 |
agattattcttatacttgttatgttgcttggaagactcaagagattcaacacggatgcaggtaatccatggaaacttctctgattcttgaatatcaattc |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35029663 |
agatcattcttatacttgttatgttgcttggaagactcaagaaattcaacacggatgcgggtaatccatggaaacttctctgattcttgaatatcaattc |
35029564 |
T |
 |
| Q |
107 |
tacccaacatcagctccgatttcacacaaatgtgtgatctatgatcgatttcatatcacttgtaaccaatgtacaaattgtcttaaaatgaccaaggaaa |
206 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35029563 |
tacccaacatcaactctgatttcacacaaatgtgtgatctatgatcgatttcatatcacttgtaaccaatgtacaaattatcttaaaatgaccaaggaaa |
35029464 |
T |
 |
| Q |
207 |
tttaaatgtgtgaaaaaattattccacttccacgcagtgtagca |
250 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
35029463 |
tttaaatgtgtgaaaaatttattccacttccacgcaatgtagca |
35029420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 92
Target Start/End: Complemental strand, 34970366 - 34970281
Alignment:
| Q |
7 |
agattattcttatacttgttatgttgcttggaagactcaagagattcaacacggatgcaggtaatccatggaaacttctctgattc |
92 |
Q |
| |
|
|||| ||||| |||||| |||||||| ||||||| || || | |||||||| ||||| ||| || ||||||||||||||||||||| |
|
|
| T |
34970366 |
agatcattctcatacttattatgttgtttggaaggcttaaaaaattcaacatggatggaggcaagccatggaaacttctctgattc |
34970281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University