View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_low_27 (Length: 249)
Name: NF5381_low_27
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 32 - 226
Target Start/End: Complemental strand, 48168118 - 48167924
Alignment:
| Q |
32 |
aatgatttctgcaataaatttaagtgtgggatctctcttaatttaatcacaattattctcaaatatggaccccctcctgggttactcgtaaaacaaggga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48168118 |
aatgatttctgcaataaatttaagtgtgggatctctcttaatttaatcacaattattctcaaatatggaccccctcctgggttactcgtaaaacaaggga |
48168019 |
T |
|
| Q |
132 |
tctagtgcctctccattgagccaattatgacgcaccgaccttcatgaactttgaggtaatgtagattataaaattgtactcactccacctacaaa |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48168018 |
tctagtgcctctccattgagccaattatgacgcaccgaccttcatgaactttgaggtaatgtagattataaaattgtactcactccacctacaaa |
48167924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University