View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_low_28 (Length: 246)
Name: NF5381_low_28
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_low_28 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 9409006 - 9408788
Alignment:
| Q |
18 |
ataggtttcgattattttcatgtaatgtaatatgctttgtctttatgatnnnnnnnngagtaatatcctttagatttagaacttaacgaaaaggtat-ac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
9409006 |
ataggtttcgattattttcatgtaatgtaatatgctttgtct--atgataaaaaaaagagtaatatcctttagatttagaacttaacgaaaaggtattac |
9408909 |
T |
 |
| Q |
117 |
cctttggtatatttggtatattaatgaattgaaaaagaaaactgcatgcacagaaaaatagtacgataaacataaaatatttaactgttcatgctgatca |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9408908 |
cctttggtatatt---------aatgaattgaaaaagaaaacttcatgcacagaaaaatagtacgataaacataagatatttaactgttcatgctgatca |
9408818 |
T |
 |
| Q |
217 |
gtcacaataaagaaagaaaagataactact |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9408817 |
gtcacaataaagaaagaaaagataactact |
9408788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University