View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_low_29 (Length: 244)
Name: NF5381_low_29
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 23 - 228
Target Start/End: Complemental strand, 688047 - 687847
Alignment:
| Q |
23 |
attcattcatttgtactgcggataaagtttctgactagtaattgatttaactcactgaaatggaagcttgtttgttgcttatatattttctgatctgcat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
688047 |
attcattcatttgtactgcggataaagtttctgactagtaattgatttaactcactgaaatggaagcttgtttgttgcttatatattttctgatctgcat |
687948 |
T |
 |
| Q |
123 |
caaattgaatttttgcacagtttaatacgttatttttgaacgccttacgaacccatcttaattttttaggaaaagactagttttgttttgattttaacaa |
222 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
687947 |
caaattgaatttttgcacagtttaatatgtta-ttttgaacgcctt----acccatcttaatattttaggaaaagactagttttgttttgattataacaa |
687853 |
T |
 |
| Q |
223 |
atgatt |
228 |
Q |
| |
|
|||||| |
|
|
| T |
687852 |
atgatt |
687847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University