View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5381_low_30 (Length: 244)
Name: NF5381_low_30
Description: NF5381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5381_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 227
Target Start/End: Original strand, 39396499 - 39396708
Alignment:
| Q |
18 |
gtattttggacaaatcttgattcagtaaagttattgaacatgtttcatttgatattgatccttgacacaaaacaaataggtacaaacaaccattgcttaa |
117 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396499 |
gtattttggacacatcttgattcagtgaagttattgaacatgtttcatttgatattgatccttgacacaaaacaaataggtacaaacaaccattgcttaa |
39396598 |
T |
|
| Q |
118 |
aattgttgatgtaacatctacaaagttatctttttcggcagcttttgcttatttggaacatgaacaacaagataattttatttgggcattccaaaatgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39396599 |
aattgttgatgtaacatctacaaagttatctttttcggcagcttttgcttatttggaacatgaacaacaagataattttatttgggcattccaaaatgtt |
39396698 |
T |
|
| Q |
218 |
agatagttca |
227 |
Q |
| |
|
|||||||||| |
|
|
| T |
39396699 |
agatagttca |
39396708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 180
Target Start/End: Original strand, 43598128 - 43598202
Alignment:
| Q |
106 |
accattgcttaaaattgttgatgtaacatctacaaagttatctttttcggcagcttttgcttatttggaacatga |
180 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||| | |||| || |||||||||||||||||||||||| |
|
|
| T |
43598128 |
accattgctttaaattgttagcgtaacatctatgaagttaacgtttttggtagcttttgcttatttggaacatga |
43598202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University