View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5382-Insertion-1 (Length: 82)

Name: NF5382-Insertion-1
Description: NF5382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5382-Insertion-1
NF5382-Insertion-1
[»] chr2 (3 HSPs)
chr2 (7-78)||(30350885-30350956)
chr2 (7-82)||(30338614-30338689)
chr2 (7-78)||(30360463-30360534)


Alignment Details
Target: chr2 (Bit Score: 72; Significance: 2e-33; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 2e-33
Query Start/End: Original strand, 7 - 78
Target Start/End: Complemental strand, 30350956 - 30350885
Alignment:
Q  7 acaagcaatgaatccaggtttctctcgtttgtctgctttagaagagagcataattaacgtcccaacatacca 78  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30350956 acaagcaatgaatccaggtttctctcgtttgtctgctttagaagagagcataattaacgtcccaacatacca 30350885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 7 - 82
Target Start/End: Complemental strand, 30338689 - 30338614
Alignment:
Q  7 acaagcaatgaatccaggtttctctcgtttgtctgctttagaagagagcataattaacgtcccaacataccatggg 82  Q
    |||||||||| ||||||||||||||||||||||| |||| ||| ||||||||||||||  ||||||||||||||||    
T  30338689 acaagcaatgtatccaggtttctctcgtttgtctactttggaaaagagcataattaacaccccaacataccatggg 30338614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 7 - 78
Target Start/End: Complemental strand, 30360534 - 30360463
Alignment:
Q  7 acaagcaatgaatccaggtttctctcgtttgtctgctttagaagagagcataattaacgtcccaacatacca 78  Q
    |||||| |||||||||||||||||||| | |||| || ||||| | |||||||| |  | ||||||||||||    
T  30360534 acaagcgatgaatccaggtttctctcgatagtctactctagaacaaagcataataattgccccaacatacca 30360463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University