View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5382-Insertion-6 (Length: 120)
Name: NF5382-Insertion-6
Description: NF5382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5382-Insertion-6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 7e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 7e-19
Query Start/End: Original strand, 65 - 116
Target Start/End: Original strand, 32311694 - 32311745
Alignment:
| Q |
65 |
aagataccctcttgatgcatgtggattaggttcaatgtcggaaacattgtta |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32311694 |
aagaaaccctcttgatgcatgtggattaggttcaatgtcggaaacattgtta |
32311745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University