View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5382_low_5 (Length: 352)
Name: NF5382_low_5
Description: NF5382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5382_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 3e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 181 - 336
Target Start/End: Original strand, 6307640 - 6307795
Alignment:
| Q |
181 |
gattgacttggaagtcttggaagaaaattgtgggaaaattattcaatcaataatatttgttgcttttctctattttgtgtttgactttgtctaattccac |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307640 |
gattgacttggaagtcttggaagaaaattgttggaaaactatttaatcaataatatttgttgcttttctctattttgtgtttgactttgtctaattccac |
6307739 |
T |
|
| Q |
281 |
tcaaccaattttatagtggatagcttgcttgaataggatgcttcggggattaagat |
336 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6307740 |
taaaccaattttatagtggatagcttgcttgaataggatgcttcggggattaagat |
6307795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 38 - 109
Target Start/End: Original strand, 6307496 - 6307567
Alignment:
| Q |
38 |
tataattaagtttatctattttatttattaaatgtaatttatgtgctttaatctatctcatttaatttagtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6307496 |
tataattaagtttatctattttatttattaaatgtaatttatgtgctttaatttatctcatttaatttagtt |
6307567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University