View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5383-Insertion-5 (Length: 208)
Name: NF5383-Insertion-5
Description: NF5383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5383-Insertion-5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 8 - 111
Target Start/End: Complemental strand, 4001698 - 4001595
Alignment:
| Q |
8 |
catatgtcaaaaatttatctaaaattaaaaagagccatgacatccttctcctagtccatactccacgattccactcactaaactacaaatttgtcttcct |
107 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4001698 |
catatgtcataaatttatccaaaattaaaaaaagtcatgacacccttctcctagtccatactccacgattccactcactaaactacaaaattgtcttcct |
4001599 |
T |
|
| Q |
108 |
tcac |
111 |
Q |
| |
|
|||| |
|
|
| T |
4001598 |
tcac |
4001595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 167 - 208
Target Start/End: Complemental strand, 4001541 - 4001500
Alignment:
| Q |
167 |
tctactttttactccttacttaccattattttgtttcgtcgt |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4001541 |
tctactttttactccttacttatcattattttgtttcgtcgt |
4001500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University