View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5384_high_13 (Length: 254)
Name: NF5384_high_13
Description: NF5384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5384_high_13 |
 |  |
|
| [»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 254
Target Start/End: Complemental strand, 33897241 - 33897006
Alignment:
| Q |
19 |
tatacaaaagcggtcgtgttgagaatttaataggtgaagaatttcttcctccatcccttgatcaagcaaccaacgttgaatcaaaagacgttgtaatctc |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33897241 |
tatacaaaagcggtcgtgttgaaaatttaataggtgaagaatttcttcctccatcccttgatcaagcaaccaacgttgaatcaaaagacgttgtaatctc |
33897142 |
T |
 |
| Q |
119 |
cgaagaacataacatctcagctagacttttcattcccaaaaccaatcacccaccaacccaaaaactccctgtctttgtctacttccatggtggtggtttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33897141 |
cgaagaacataacatctcagctagacttttcattcccaaaaccaatcacccaccaatccaaaaactccctgtctttgtctacttccatggtggtggtttc |
33897042 |
T |
 |
| Q |
219 |
tgcattgaaacacctttctcaccatgctaccataac |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33897041 |
tgcattgaaacacctttctcaccatgctaccataac |
33897006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 56 - 254
Target Start/End: Original strand, 33901647 - 33901845
Alignment:
| Q |
56 |
agaatttcttcctccatcccttgatcaagcaaccaacgttgaatcaaaagacgttgtaatctccgaagaacataacatctcagctagacttttcattccc |
155 |
Q |
| |
|
|||| ||||||||||||| ||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33901647 |
agaagttcttcctccatctcttgatcccaaaaccaacgttgaatcaaaagatgttgttatctccgaagaacataacatctcagctagacttttcattcca |
33901746 |
T |
 |
| Q |
156 |
aaaaccaatcacccaccaacccaaaaactccctgtctttgtctacttccatggtggtggtttctgcattgaaacacctttctcaccatgctaccataac |
254 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| | |||| ||| |||||||||||| ||||||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
33901747 |
aaaaccaattacccaccaacccaaaaactccctcttcttgtttacatccatggtggtgctttctgcattgaaactcctttttcaccaaactaccataac |
33901845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 171 - 242
Target Start/End: Complemental strand, 33918568 - 33918497
Alignment:
| Q |
171 |
ccaacccaaaaactccctgtctttgtctacttccatggtggtggtttctgcattgaaacacctttctcacca |
242 |
Q |
| |
|
|||| ||||||||||||| || |||| |||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
33918568 |
ccaaaccaaaaactccctctccttgtttacttccatggtggtggtttctgcgtagaaacacctttctcacca |
33918497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 171 - 242
Target Start/End: Complemental strand, 19643045 - 19642974
Alignment:
| Q |
171 |
ccaacccaaaaactccctgtctttgtctacttccatggtggtggtttctgcattgaaacacctttctcacca |
242 |
Q |
| |
|
|||| ||||||||||||| || |||| |||||||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
19643045 |
ccaaaccaaaaactccctctccttgtttacttccacggtggtggtttctgcgtagaaacacctttctcacca |
19642974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University