View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5384_low_12 (Length: 294)
Name: NF5384_low_12
Description: NF5384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5384_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 9e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 97 - 261
Target Start/End: Original strand, 17356087 - 17356249
Alignment:
| Q |
97 |
gttaagtcaatgttttgggattttggagattttgttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcacctt |
196 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17356087 |
gttaaatcaatattttgggattttggagattttgttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgtttttcttcacctt |
17356186 |
T |
|
| Q |
197 |
attgtttgtagaaaagcagcatataattgttttggatttttcatgaaaaattattctaaattcat |
261 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17356187 |
cttgtttgtacaaaagcagc--ataattgttttggatttttcatgaaaaattattctaaattcat |
17356249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 126 - 216
Target Start/End: Complemental strand, 36620043 - 36619953
Alignment:
| Q |
126 |
ttttgttgatttgtattattgtgtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaaaagcagc |
216 |
Q |
| |
|
||||||||| || |||| || |||| |||||| ||||||| |||| | | |||||||||||||||||| ||||||||| || | ||||||| |
|
|
| T |
36620043 |
ttttgttgaattttattgttttgtgtttcatgtgaacttcaattttgcgttttgttgttttccttcactttattgtttctacagaagcagc |
36619953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University