View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5384_low_18 (Length: 246)

Name: NF5384_low_18
Description: NF5384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5384_low_18
NF5384_low_18
[»] chr5 (1 HSPs)
chr5 (1-49)||(19024082-19024130)


Alignment Details
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 19024130 - 19024082
Alignment:
1 ctatcagcaaagaaactgacatattttttcctcttggaaaaataacact 49  Q
    |||||| |||||||||| |||||||||||||||||||||||||||||||    
19024130 ctatcatcaaagaaactaacatattttttcctcttggaaaaataacact 19024082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University