View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5384_low_5 (Length: 364)
Name: NF5384_low_5
Description: NF5384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5384_low_5 |
 | |
|
| [»] scaffold0687 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 2 - 348
Target Start/End: Original strand, 7604385 - 7604731
Alignment:
| Q |
2 |
ttccattcatcttcttcgtaactgtaaccttcacattccttctcaaacccttaccaatttcttcccctctaatctctcaactaactcgccgcaaatttca |
101 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7604385 |
ttccattcaacttcttcataaccgtaaccttcacattccttctcaaacccttaccaatttcttcttctctaatctctcaactaactcgccgcaaatttca |
7604484 |
T |
|
| Q |
102 |
tcatctccgatggccggacagttctccagctccgttgaattcggtctcaatctctctaaacgaattcaccacacaaaactatcagctccagctccattac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7604485 |
ccatctccgatggccggacagttctccagctccgttgaattcggtctcaatctctcaaaacgaattcaccacacaaaactatcagctccagctccattac |
7604584 |
T |
|
| Q |
202 |
cggagatgacaaggtcgattgatgaacacctaccatcggcgccgatgtgttacgcggtgatacctgatccagacatagtagacaatcctgacattcgaag |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7604585 |
cggagatgacaaggtcgattgatgaacacctaccgtcagcgccgatgtgttacgcggtgatacctgatccagacatagtagacaatcctgacattcgaag |
7604684 |
T |
|
| Q |
302 |
ctatcaaccgtatgtgtacggacggtgtgatcctccggcgttgatac |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7604685 |
ctatcaaccgtatgtgtacggacggtgtgatcctccagcgttgatac |
7604731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0687 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0687
Description:
Target: scaffold0687; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 2 - 59
Target Start/End: Original strand, 2069 - 2126
Alignment:
| Q |
2 |
ttccattcatcttcttcgtaactgtaaccttcacattccttctcaaacccttaccaat |
59 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2069 |
ttccattcaacttcttcataaccgtaaccttcacattccttctcaaacccttaccaat |
2126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University