View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5385-Insertion-1 (Length: 180)
Name: NF5385-Insertion-1
Description: NF5385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5385-Insertion-1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 6e-48; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 6e-48
Query Start/End: Original strand, 72 - 168
Target Start/End: Original strand, 17567039 - 17567135
Alignment:
| Q |
72 |
ttatttcattggtttttatacttcacttgatttgatcacttaccttttacttatttttgtgtgtgtgcatttgcgaaaatgcagttattttaggttt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17567039 |
ttatttcattggtttttatacttcacttgatttgatcacttaccttttacttatttttgtgtgtgtgcatttgcgaaaatgcagttattttaggttt |
17567135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University