View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5385-Insertion-6 (Length: 337)
Name: NF5385-Insertion-6
Description: NF5385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5385-Insertion-6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 7 - 335
Target Start/End: Original strand, 30177871 - 30178200
Alignment:
| Q |
7 |
actaagggcccaaagatatggagggtttatactcgcaggggaaagtcagctaaaggggagtgagagtgccacctgaattggcagcttctataaggagggg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30177871 |
actaagggcccaaagatatggagggtttatactcgcaggggaaagtcagctaaaggggagtgagagtgtcacctgaattggcagcttctataaggagggg |
30177970 |
T |
|
| Q |
107 |
ataatcatttctgttaagtcagttgtaataaaagggatagtgagtccagtaatctgggtatcttggaatatctc-taagtttgttagaatggagagcaca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30177971 |
ataatcatttctgttaagtcagttgtaataaaagggatagtgagtccagtaatctgggtatcttggaatatctcttaagtttgttagaatggagagcaca |
30178070 |
T |
|
| Q |
206 |
cactctgtaggggctgaatcctgtggcagtcagtagcaataccattttcctatgtaaatcccttatttgccatcaataataccgaatcttcctctcaatt |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30178071 |
cactctgtaggggctgaatcctgtggcagtcagtagcaataccattttcctctgtaaatcccttatttgccatcaataatactgaatcttcctctcaatt |
30178170 |
T |
|
| Q |
306 |
tttcttctttatttctcatgattgtgtttg |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
30178171 |
tttcttctttatttctcatgattgtgtttg |
30178200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University