View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5385-Insertion-7 (Length: 325)
Name: NF5385-Insertion-7
Description: NF5385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5385-Insertion-7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 7e-40; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 232 - 323
Target Start/End: Complemental strand, 52380322 - 52380231
Alignment:
| Q |
232 |
gagaagactgccctacttaatgggccgggcttgtcattttcactaatgggtacccggtactttttatcaaattaataggctattacttttcc |
323 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52380322 |
gagaagactgcactacttaatgggccgggcttgtcattttcactaatgggtacccggtactttttatcaaattaatagactattacttttcc |
52380231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 5 - 81
Target Start/End: Complemental strand, 52380531 - 52380455
Alignment:
| Q |
5 |
acaagaatgaagtgtgaagaaggaaaatggaatgaaaatgattatgttgatgcatgtcagaagtgaagaagtgttat |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380531 |
acaagaatgaagtgtgaagaaggaaaatggaatgaaaatgattatgttgatgcatgtcagaagtgaagaagtgttat |
52380455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 105 - 141
Target Start/End: Complemental strand, 52380435 - 52380399
Alignment:
| Q |
105 |
agggtttatgattctacggggggtttgatttccctcc |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52380435 |
agggtttatgattctacggggggtttgatttccctcc |
52380399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University