View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5385_high_10 (Length: 268)
Name: NF5385_high_10
Description: NF5385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5385_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 30177876 - 30177632
Alignment:
| Q |
19 |
cttagtctcatggtgcatgaacgggtcacaagcccaataacttgtgtgccggtcctaacaccttttctctgtttgtttgaagttgtgagttgtgacacca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30177876 |
cttagtctcatggtgcatgaacgggtcacaagctcaataacttgtgtgccggtcctaacaccttttctctgtttgtttgaagttgtgagttgtgacacca |
30177777 |
T |
 |
| Q |
119 |
tcaagtattggcttcagaccaaatatcattttggtttttggtttgatgtggtgcacctttcaattaaggcctcattttccggagcgagcacagacctaat |
218 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30177776 |
tcaagtatgggcttcagaccaaatatcattttggtttttggtttgatgtggtgcacctttcaattaaggcctcattttccggagcgagcacagacctaat |
30177677 |
T |
 |
| Q |
219 |
atcgttgcagtttggtttttctcattgttgagaacctttgcttct |
263 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30177676 |
atcattgcagtttggtttttctcattgttgagaacgtttgcttct |
30177632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University