View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5385_low_12 (Length: 246)
Name: NF5385_low_12
Description: NF5385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5385_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 10459373 - 10459145
Alignment:
| Q |
1 |
aatgtagggcaccatgtaaaaacctgcagacgaaatagtgaatccgaagggtcttctcag----gtcaacaggttatgtaggtgacttcttcggttatgt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
10459373 |
aatgtagggcaccatgtaaaaacctgcagacgaaatagtgaatccgaaggatcttctcagttaggtcaacaggttatgcaggtgacttcttcggt-atgt |
10459275 |
T |
 |
| Q |
97 |
aatggactggacggtagcatacgattttggaattaaattttcaatccagtggtatccgcaactgactgcataggtactgttgtgaatcagaaattgattt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10459274 |
aatggactggacggtagcatacgattttggaattaaattttcgatccagtggtatccgcaactgactgcataggtactgttgtgaatcagaaattgattt |
10459175 |
T |
 |
| Q |
197 |
gcttccttaattacgtatattagtttgttc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10459174 |
gcttccttaattacgtatattagtttgttc |
10459145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University