View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5385_low_14 (Length: 228)
Name: NF5385_low_14
Description: NF5385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5385_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 8767319 - 8767217
Alignment:
| Q |
1 |
gatgggagtgtgaaggatggaagtgaacccgaaaagtgacagatcctttcttttcttacatataagnnnnnnnnngctgctgtgctggggttttctatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8767319 |
gatgggagtgtgaaggatggaagtgaacccgaaaagtgacagatcctttcttttcttacatataagtttatttttgctgctgtgctggggttttctatgt |
8767220 |
T |
|
| Q |
101 |
ttc |
103 |
Q |
| |
|
||| |
|
|
| T |
8767219 |
ttc |
8767217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University