View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5385_low_6 (Length: 373)
Name: NF5385_low_6
Description: NF5385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5385_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 19 - 362
Target Start/End: Complemental strand, 43909055 - 43908712
Alignment:
| Q |
19 |
actaaggaagtagctctatcatttgcttgtaatgtatccatcctacttgattctctttgaggaagagattttcttctccaagttttagcaacaggtgaac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43909055 |
actaaggaagtagctctatcatttgcttgtaatgtatccatcctacttgattctctttgaggaagagattttcttctccaagttttagcaacaggtgaac |
43908956 |
T |
 |
| Q |
119 |
ttgatttttcataccttctattttgatcctttacatgttcttttcccatgccaggttcattaggagtttgtttcttaacgtatcgcattaaaagtccatc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43908955 |
ttgatttttcataccttctattttgatcctttacatgttcttttcccatgccaggttcattaggagtttgtttgttaacgtatcgcattaaaagtccatc |
43908856 |
T |
 |
| Q |
219 |
taatatcatttcttcatccaatgcaccacctgtttcagaaaaatctttaactgtgttttcaacaggtggtggttttagaggtctccttctcactgatctt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43908855 |
taatatcatttcttcatccaatgcaccacctgtttcagaaaaatctttaactgtgttttcaacaggtggtggttttagaggtctccttctcactgatctt |
43908756 |
T |
 |
| Q |
319 |
ggtttcggcttttcagcaggtagagcttcaactgttttcttcat |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43908755 |
ggtttcggcttttcagcaggtagagcttcaactgttttcttcat |
43908712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University