View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5385_low_8 (Length: 329)
Name: NF5385_low_8
Description: NF5385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5385_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 16 - 321
Target Start/End: Original strand, 36272768 - 36273073
Alignment:
| Q |
16 |
cgtatcacagcttgcttctccagtatatgtagaagcttgtaagatgctcggtgtatacaacaatcttcaacatttaacaaagtcagtttcatacatcaaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36272768 |
cgtatcacagcttgcttctccagtatatgtagaagcttgtaagatgctcggtgtatacaacgatcttcaacatttaacaaagtcagtttcatacatcaaa |
36272867 |
T |
|
| Q |
116 |
ggaatattattagatgctgaactaaagcagatgcatggatattctgaccataagttgtataattggctatggcggatcagacgtgtcttttctgatgctg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36272868 |
ggaatattattagatgctgaactaaagcagatgcatggatattctgaccataagttgtataattggctatggcggatcagacatgtcttttctgatgctg |
36272967 |
T |
|
| Q |
216 |
aaaaccttctggatgaagttgagctggaaaacttacaaaagaaagtaatcaaagtgcgtcgcagctgcagcaatacgatcataaccaaggtaaaccactt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36272968 |
aaaaccttctggatgaagttgagctggaaaacttacaaaagaaagtaatcaaagtgtgtcgcagctgcagcaatatgatcataaccaaggtaaaccactt |
36273067 |
T |
|
| Q |
316 |
cttctc |
321 |
Q |
| |
|
|||||| |
|
|
| T |
36273068 |
cttctc |
36273073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University