View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5387-Insertion-13 (Length: 355)
Name: NF5387-Insertion-13
Description: NF5387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5387-Insertion-13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 8 - 326
Target Start/End: Complemental strand, 48669094 - 48668776
Alignment:
| Q |
8 |
acttagacgccaggcttgatcttcaaaccacaaatggaaatggagccttccaaccacacatgggaaaccgtgctttaatggatctctgcattatgtcttc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48669094 |
acttagacgccaggcttgatcttcaaaccacaaatggaaatggagccttccaaccacacatgggaaaccgtgctttaatggatctctgcattatgtcttc |
48668995 |
T |
|
| Q |
108 |
caagatagcatatgagaaccctaaactcatcaaaaatgtcgtcaaccaccattggaacatgcactttgtagatttctatcattgttggaatggtatgttg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48668994 |
caagatagcatatgagaaccctaaactcatcaaaaatgtcgtcaaccaccattggaacatgcactttgtagatttctatcattgttggaatggtatgttg |
48668895 |
T |
|
| Q |
208 |
cattatctacaatcataattaatgatttcattcaattcaacttttctcacttcctaatccttccttcatcaatcaattcttagatttcgagaaacagatg |
307 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48668894 |
cattatctacaatcataattaattatttcattcaattcaacttttctcacttcctattccttccttcatcaatcaattcttagatttcgagaaacagatg |
48668795 |
T |
|
| Q |
308 |
tccactcaagttttcatcc |
326 |
Q |
| |
|
||||||||||| ||||||| |
|
|
| T |
48668794 |
tccactcaagtcttcatcc |
48668776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University