View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5387-Insertion-14 (Length: 247)
Name: NF5387-Insertion-14
Description: NF5387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5387-Insertion-14 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 247
Target Start/End: Original strand, 26042565 - 26042805
Alignment:
| Q |
8 |
ctttgtgtaggattcagttgccaactagagcaagcaaatgaatggtgagatgtttttgttgctttgtttagtttattgtggtaatccttaaataagtttg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
26042565 |
ctttgtgtaggattcagttgccaactagaacaagcaaatgaatggtgacatgtttttgttgctttgtttagtttattgtagtaatctttaaataagtttg |
26042664 |
T |
 |
| Q |
108 |
agattgatttttcagatgtgtttatctttcttgaattgtaattggcactggtttttaattggaga-gatacgtgtgattatgtttgtcatgtttaatggt |
206 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26042665 |
agaatgatttttcagatgtgtttatctttcttgaattgtaattggcactggtttttaattggagaggatacgtgtgattatgtttgtcatgtttaatggt |
26042764 |
T |
 |
| Q |
207 |
agtgtttattaaagtttaagactcctgtaaattgtgtgacc |
247 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
26042765 |
agtgtttattaaagtttaagactcttgtaaattgtgtgacc |
26042805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 8 - 90
Target Start/End: Original strand, 26048878 - 26048960
Alignment:
| Q |
8 |
ctttgtgtaggattcagttgccaactagagcaagcaaatgaatggtgagatgtttttgttgctttgtttagtttattgtggta |
90 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26048878 |
ctttgtgtaggattcagttgccaactagaacaagcaaatgaatggtgacatgtttttgttgctttgtttagtttattgtggta |
26048960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University