View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5387_high_25 (Length: 235)

Name: NF5387_high_25
Description: NF5387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5387_high_25
NF5387_high_25
[»] chr4 (1 HSPs)
chr4 (48-235)||(48117885-48118072)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 48 - 235
Target Start/End: Original strand, 48117885 - 48118072
Alignment:
48 tctttgatgattgatcaagaaactgcaacacggttcatgacaaaaaatcgagtaggttttggttcaaaagtcttccgcctatgaagatcatggctagagg 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
48117885 tctttgatgattgatcaagaaactgcaacacggttcatgacaaaaaatcgagtaggttttggttgaaaagtcttccgcctatgaagatcatggctagagg 48117984  T
148 gatgctttattattttgaggagaattgccttcaatgaattattagcatttgcagccatgaccatcgatgagcgatcaaaataatgatt 235  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48117985 gatgcttaattattttgaggagaattgccttcaatgaattattagcatttgcagccatgaccatcgatgagcgatcaaaataatgatt 48118072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University