View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5387_low_25 (Length: 242)
Name: NF5387_low_25
Description: NF5387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5387_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 310088 - 310301
Alignment:
| Q |
9 |
aaatccctatcacattagttagtccctaagatcttatcaaatgtcaatatataacagtagggactaacaagaaagatttatcaaaacattagaaaccatt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
310088 |
aaatccctatcacattagttagtccctaagatcttgtcaaatgtcaatatataacagtagggactaacaagaaagatttatcaaaacattagaaaccatt |
310187 |
T |
 |
| Q |
109 |
ataaaacattagagagtagtacttagtattttcaaatcatgcaggactgactaaccaagagaaagagtgacagcctacgcagcactacatacacttcata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
310188 |
ataaaacattagagagtagtacttagtattttcaaatcatgcaggactgactaaccaagagaaagagtgacagcctacacagcactacatacacttcata |
310287 |
T |
 |
| Q |
209 |
tggaaggtgtgcct |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
310288 |
tggaaggtgtgcct |
310301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University