View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5387_low_29 (Length: 235)
Name: NF5387_low_29
Description: NF5387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5387_low_29 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 48 - 235
Target Start/End: Original strand, 48117885 - 48118072
Alignment:
| Q |
48 |
tctttgatgattgatcaagaaactgcaacacggttcatgacaaaaaatcgagtaggttttggttcaaaagtcttccgcctatgaagatcatggctagagg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48117885 |
tctttgatgattgatcaagaaactgcaacacggttcatgacaaaaaatcgagtaggttttggttgaaaagtcttccgcctatgaagatcatggctagagg |
48117984 |
T |
 |
| Q |
148 |
gatgctttattattttgaggagaattgccttcaatgaattattagcatttgcagccatgaccatcgatgagcgatcaaaataatgatt |
235 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48117985 |
gatgcttaattattttgaggagaattgccttcaatgaattattagcatttgcagccatgaccatcgatgagcgatcaaaataatgatt |
48118072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University