View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5387_low_31 (Length: 231)
Name: NF5387_low_31
Description: NF5387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5387_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 30289942 - 30290101
Alignment:
| Q |
1 |
tttccatagatatcatgaagtcc---ctgcttctatatctttaggtctcctgattgttttggaatcggttggccgatgcgtgatcaggagcacgattttt |
97 |
Q |
| |
|
|||||||| ||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30289942 |
tttccatatatatcatgaggtccttgctgcttctatatgtttaggtctcctgattgttttggaatcggttggccgatgcgtgatcaggaccacgattttt |
30290041 |
T |
 |
| Q |
98 |
tctttgtaaaaaccaaagacaaacctgatttcaagaatgctcttgttgtatcacctgctc |
157 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30290042 |
tctttgtaaaaaccaaagataaacctgatttcaagaatgctcttgttgtatcacatgctc |
30290101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University