View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5387_low_32 (Length: 227)
Name: NF5387_low_32
Description: NF5387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5387_low_32 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 48118385 - 48118167
Alignment:
| Q |
7 |
gtttttacctaataatataccataatgagtctactctattaagccgctttttcatggcctcaaaatataaaaactctcatatagatacgtttattaactc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
48118385 |
gtttttacctaataatataccataatgagtctactctattaagccgctttttcatggcctcaaaatataaa--ctctcatatagataggtttattaactc |
48118288 |
T |
|
| Q |
107 |
gttctttacaatttacatacatattcccccgatcgatctatatggcctcaagaaatgcttcttccatgacaaaccctcactcccacacaaatcaaccaca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48118287 |
gttctttacaatttacatacatattcccccgatcgatctatatggcctcaagaaatgcttcttccatgacaaaccctcattcccacacaaatcaaccaca |
48118188 |
T |
|
| Q |
207 |
tcgtacgtgcatgtgctcacc |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
48118187 |
tcgtacgtgcatgtgctcacc |
48118167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University