View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5387_low_9 (Length: 412)
Name: NF5387_low_9
Description: NF5387
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5387_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 34 - 395
Target Start/End: Complemental strand, 38747948 - 38747584
Alignment:
| Q |
34 |
ataattctccaacttcaacactttttggtatgtctcatttttcttcacctccggcatcaccacctatgtctccgatgaagccacgaaacggtgtttcatc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747948 |
ataattctccaacttcaacactttttggtatgtctcatttttcttcacctccggcatcaccacctatgtctccgatgaagccacgaaacggtgtttcatc |
38747849 |
T |
|
| Q |
134 |
gctttcacgctatggttcttcgattaatagtaacaatcttcgttatagagacatgcttattgatcttttgggttcttttgaagggatgaatttcaatgac |
233 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747848 |
gctttcacgctacggttcttcaattaatagtaacaatcttcgttatagagacatgcttattgatcttttgggttcttttgaagggatgaatttcaatgac |
38747749 |
T |
|
| Q |
234 |
ggttca---nnnnnnnnnnnnnnnnnacctgtttctgtttctgctgctaaagcacttcagatacaaaacatgggttatcttgaatctcttgatgttccag |
330 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747748 |
ggttcatcttctgcttcttcttcttcacctgtttctgtttctgctgctaaagcacttcagatacaaaacatgggttatcttgaatctcttgatgttccag |
38747649 |
T |
|
| Q |
331 |
aggaacagaatcagcaacagtttattgtttcaccttcttcttcttttgatcatcaacaacatttc |
395 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38747648 |
aggaacagaatcagcaacagtttattgtttcaccttcttcttcatttgatcatcaacaacatttc |
38747584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University