View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5388-Insertion-13 (Length: 295)
Name: NF5388-Insertion-13
Description: NF5388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5388-Insertion-13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 12 - 292
Target Start/End: Complemental strand, 3685944 - 3685664
Alignment:
| Q |
12 |
atgtgatagacttatcagtgttcatagggggcagtggtgcagcatgagaaactatatgtgtctcatctatcacttgttacacaacctttcatgcttggtt |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3685944 |
atgtgatagacttatcagtgttcataaggggcagtggtgcagcatgagaaactatatgtgtctcatctatcacttgttacgcaacctttcatgcttggtt |
3685845 |
T |
 |
| Q |
112 |
gctcatcttatattgctagttatgcttcatcagtacgtggctgagcatcacctgttactgttaattcagattgcacaactatatgttcattggctggagg |
211 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3685844 |
gctcatcttatattgctagtcgtgcttcatcagtacgtggttgaaaatcacctgttactgttaattcagattgcacaactatatgttcattgactggagg |
3685745 |
T |
 |
| Q |
212 |
tgaacatttcgagcaaatggtgtcttaattgctttcgaaaaacctatgcatgcagggttatcttttgcttgcctggtttct |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3685744 |
tgaacatttcgagcaaatggtgtcttaattgctttcgaaaaacctatgcatgcagggttatcttttgcttgcctggtttct |
3685664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University