View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5388-Insertion-14 (Length: 175)
Name: NF5388-Insertion-14
Description: NF5388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5388-Insertion-14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 8 - 149
Target Start/End: Original strand, 23527974 - 23528115
Alignment:
| Q |
8 |
ataacgttgttgttggtgttacctttgagctgtttttgaagaagaaggctggcttgagacgccatcaagagagaattgttttgaaaaccgacagttggat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23527974 |
ataacgttgttgttggtgttacctttgagctgtttttgaagaagaaggctggcttgagacgccatcaagagagaattgttttgaaaaccgacagttggat |
23528073 |
T |
|
| Q |
108 |
tgaatatttatagagaaagaaagatggttggcctccctgtga |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23528074 |
tgaatatttatagagaaagaaagatggttggcttccctgtga |
23528115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University