View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5388_high_6 (Length: 322)
Name: NF5388_high_6
Description: NF5388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5388_high_6 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 23 - 322
Target Start/End: Complemental strand, 40064572 - 40064273
Alignment:
| Q |
23 |
gatagatacacacactttcattgtcnnnnnnngatacacactaattaagttgtgatatggtttgaattaagcctttttaatggttttaaatatatgaaag |
122 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40064572 |
gatagatacacacactttcattgtcaaaaaaagatacacactaattaagttgtgatatggtttgaattaagcctttttaatggttttaaatatatgaaag |
40064473 |
T |
 |
| Q |
123 |
taaaccaatctctttaattgatttagtgccagatattctttcatacttgattcataatgtatcacgaagtaagcataaaattttatcaagtctaacaaaa |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40064472 |
taaaccaatctctttaattgatttagtgccagatattctttcatacttgattcataatgtatcacgaagtaagcataaaattttatcaagtctaacaaaa |
40064373 |
T |
 |
| Q |
223 |
aagttggcaggcaaagtgttgcaattggccctcattcagttatattttagccatatatacttctagtcttccattgtcatcattaatttttagtttatgc |
322 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40064372 |
aagttggcaggcaaagtgttgcagttggccctcattcagttatattttagccatatatacttctagtcttccattgtcatcattaatttttagtttatgc |
40064273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University