View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5388_low_6 (Length: 350)
Name: NF5388_low_6
Description: NF5388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5388_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 19 - 170
Target Start/End: Complemental strand, 3246099 - 3245948
Alignment:
| Q |
19 |
acatagattgtgtatgacgaggatgtactggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcgatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3246099 |
acatagattgtgtatgacgaggatgtactggagatgaggtagcagaacgaggtgtaggaggaagtgcattgatacgaccagttattaatgccattcgatc |
3246000 |
T |
|
| Q |
119 |
tgaacctctttcttgaatccttcttcttctctcttctgtattgttgttgttg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245999 |
tgaacctctttcttgaatccttcttcttctctcttctgtattgttgttgttg |
3245948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 266 - 324
Target Start/End: Complemental strand, 3245859 - 3245801
Alignment:
| Q |
266 |
acgagaatgttttagaattaagacccacaaacatcgccatttgacatgttcttgtctca |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3245859 |
acgagaatgttttagaattaagacccacaaacatcgccatttgacatgttcttgtctca |
3245801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University