View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5389_low_5 (Length: 302)
Name: NF5389_low_5
Description: NF5389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5389_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 10 - 157
Target Start/End: Complemental strand, 41181382 - 41181235
Alignment:
| Q |
10 |
agaagaatacaacgatgctggcactaattgctatgatgttgaatattattatgatcaaggaggagatgttgggtattctcttcaatttggaggacctggt |
109 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||| ||||||| | ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41181382 |
agaagaatacaacgatgctggcactgtttgctatggtgttgaatattatggtgatcaaagtggaaatgttgggtattctcttcaatttggaggacctggt |
41181283 |
T |
|
| Q |
110 |
ggttattgtgagaattattaattttagtgaacttcatttgtttattac |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41181282 |
ggttattgtgagaattattaattttagtgaacatcatttgtttattac |
41181235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University