View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5390-Insertion-1 (Length: 146)
Name: NF5390-Insertion-1
Description: NF5390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5390-Insertion-1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 1e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 53756065 - 53755948
Alignment:
| Q |
8 |
aagatccctataaattcttcaactggaatgttacttacggtgacatttacccacttggagttcgtcaaagggtacgtgtgtttcaaatcaaatctcaatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53756065 |
aagatccctataaattcttcaactggaatgttacttacggtgacatttacccacttggagttcgtcaaagggtacgtgtgtttcaaatcaaatctcaatc |
53755966 |
T |
|
| Q |
108 |
tcactcactttctcatgc |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
53755965 |
tcactcactttctcatgc |
53755948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 22 - 71
Target Start/End: Complemental strand, 8572920 - 8572871
Alignment:
| Q |
22 |
ttcttcaactggaatgttacttacggtgacatttacccacttggagttcg |
71 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||| |||||||| ||||| |
|
|
| T |
8572920 |
ttcttcaactggaacgttacctatggtgacatttatccacttggtgttcg |
8572871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University